WANG Feng-xue, WEN Yong-jun, LIU Zhun, LENG Xue，LI Zhen-guang，WU Hua*
Institute of Special Animal and Plant Sciences CAAS, Jilin 132109, China
Abstract [Objective] The study aimed to investigate the effects of Nsp2 protein on porcine reproductive and respiratory syndrome virus (PRRSV) replication. [Method] Through in vitro cloning, the Nsp2 gene of highly pathogenic PRRSV TJ and attenuated TJM were amplified by RT-PCR and cloned into the plasmid pEGFP-N1, which containing enhanced green fluorescent protein expression box. The constructed plasmids pEGFP-TJ Nsp2 and pEGFP-TJM Nsp2 were transfected into Marc-145 cells and screened by G418. Anti-G418 Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells were obtained, and the expression of Nsp2 protein in anti-G418 Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells was proved by PCR and RT-PCR. The Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells were infected by PRRSV, and TCID50 was determined. [Result] The cells expressing Nsp2 gene of highly pathogenic PRRSV TJ and attenuated TJM, Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2, were stable. PRRSV replication was fast in early stage on these cells. That is to say, Nsp2 protein played a positive role in early phase of PRRSV proliferation, and the effect of Nsp2 protein of highly pathogenic PRRSV TJ was more obvious. [Conclusion] The construction of Marc-145-Nsp2 cell lines provided data for the further discuss of PRRSV replication mechanism.
Key words Porcine reproductive and respiratory syndrome virus; Nsp2 protein; Cell lines; Replication
Belonging to Nidovirales, Arterividdae, Arterivirus[1], porcine reproductive and respiratory syndrome virus (PRRSV) was obtained firstly in the late 1920s, and it has two genotypes at present, namely European genotype I and American genotype II. PRRSV genome, a single positive-strand RNA, has a length of 15.5 kb and is composed of ORF1-ORF7, encoding the nonstructural proteins from Nsp1 to Nsp12 and 6 structural proteins[2-3]. Among different PRRSV genotypes and within a genotype, the nonstructural protein 2 (Nsp2) is one of genes with the largest variation. Presently, the study on properties and functions of Nsp2 protein and its genes during peak period of highly pathogenic PRRSV have become a focus. In China, the change of highly pathogenic PRRSV in pathogenicity may result from the variation in the action mode of PRRSV and cells during PRRSV replication. According to a previous study, Nsp2 protein is related to PRRSV replication[4]. Functions of Nsp2 protein was discussed in vitro by using the reverse genetics and deletion mutagenesis technique, and the results showed that the growth ability if recombinant virus rV63 with the deletion of 63 nucleotides in Nsp2 area enhanced, which indicated that rV63 was more suitable for Marc-145 cells, and it was speculated that Nsp2 could possibly control the excessive virus replication and RNA expression[5]. Like nonstructural proteins of plague viruses and other viruses[6], these deletion may affect this kind of control function and weaken the limit.
To discuss the effects of Nsp2 protein expression on PRRSV reproduction, the plasmids pEGFP-TJ Nsp2 and pEGFP-TJM Nsp2, expressing the Nsp2 protein of highly pathogenic PRRSV TJ and attenuated TJM, were constructed, which containing enhanced green fluorescent protein (EGFP) expression box. Afterwards, the plasmids were transfected into Marc-145 cells and screened by G418 to obtain Marc-145 cells expressing the Nsp2 protein of PRRSV TJ and attenuated TJM stably. The Marc-145 cells were infected by PRRSV TJ, and the control effect of PRRSV Nsp2 protein on PRRSV replication was discussed.
1. Materials and Methods
1.1. Strains, cell lines and plasmids DH5α competent cells were bought from Invitrogen Company; Marc-145 cell lines and eukaryotic expression vector pEGFP-N1 were preserved by Institute of Special Animal and Plant Sciences of CAAS.
1.2. Regents MEM cell culture medium and fetal bovine serum were purchased from Hyclone Company; PureLink™ Quick Gel Extraction Kit, Trizol regent, M-MLV reverse transcriptase were produced by Invitrogen Company; T4 DNA ligase, ExTaq DNA polymerase, restriction endonucleases Pst I and BamH I, etc. were bought from TaKaRa Company; SuperFect Transfection Reagent was purchased from Qiangen Company; G418 was purchased from Amresco Company.
1.3. Cloning and sequencing of the Nsp2 gene of PRRSV TJ and TJM
1.3.1. Primer design. A pair of specific primers were designed and compounded according to the gene sequence of PRRSV TJ (GenBank accession No. EU860248). Upstream primer sequence Nsp2-U was 5‘GGCTGCAGGCCGGAAAGAGAGCAAG’3 , wherein the underline was restriction site Pst I; downstream primer sequence Nsp2-L was 5‘GTGGATCCCCCAGTAACCTGCCAAG’3, and the underline was restriction site BamH I.
1.3.2. RNA extraction. F3 RNA of PRRSV TJ was extracted according to the instruction of Trizol RNA extraction kit.
1.3.3. RT-PCR. For reverse transcription (RT), 1 μl of OligdT12-18 (50 ng/μl) and 5 μl RNA template were mixed well firstly, denatured for 10 min in water at 70 ℃, cooled for 5 min in ice bath, and then 4 μl of 5×buffer, 1μl of dNTP (10 mmol/L), 0.5 μl of RNAsin and 1 μl of M-MLV were put in the mixture, finally DEPC water was added to the mixture until the total volume reached 20 μl. Afterwards, the well mixed mixture was kept in water for 1 h at 37 ℃ to compound the first chain cDNA. PCR: 5 μl of 10×Ex Taq buffer, 4 μl of dNTP (2.5 mmol/L), 1 μl of upstream primer (10 μmol/L) and downstream primer (10 μmol/L) each, 3 μl of RT products, 0.5 μl of ExTaq enzyme (5 U/μl), 35.5 μl of deionized water, total volume was 25 μl. The amplification conditions included 5 min of initial denaturation at 94 ℃, 50 s of denaturation at 94 ℃, 50 s of annealing at 60.4℃ and 2.5 min of extension at 72 ℃, 30 cycles in total, and a terminal extension was conducted at 72℃ for 10 min, with heat preservation at 4℃.
1.3.4. Cloning and sequencing of PCR products. RT-PCR products were separated by agarose gel electrophoresis, and the target bars were collected according to the instruction of PureLink™ Quick Gel Extraction Kit from USA Invitrogen Company, cloned into pMD18-T vector, and transformed into DH5α competent cells of colon bacillus, and then plasmid T-Nsp2 was extracted, finally the positive recombinant ones were screened by endonuclease digesting and PCR identification and given to a biological company to measure the Nsp2 gene sequence of PRRSV TJ.
1.4. Construction of recombinant eukaryotic expression vector pEGFP-Nsp2 Plasmid T-Nsp2 and eukaryotic plasmid pEGFP-N1 vector were treated by restriction endonucleases Pst I and BamH I simultaneously, and then connected with the collected target fragments with the aid of T4 ligase for 6-8 h, finally the positive recombinant eukaryotic expression vectors were named pEGFP-TJ Nsp2 and pEGFP-TJM Nsp2.
1.5. Determination of the optimal working mass concentration of G418 The cryopreserved Marc-145 cells were recovered and cultured, and the cells in logarithmic growth phase were inoculated the a 24-well culture plate where there were 50 000 cells in each well. When the cells adhered to the wall, G418 working fluid was added to each well, so that its finial mass concentration varied from 0.1 to 1 g/L, with an increase of 0.1 g/L. The cells were continuously cultured for 14 d, and the culture solution was renewed every 3 d. Meanwhile, the death status of the cells were observed to determine the best working mass concentration of G418 (the minimum lethal mass concentration.
1.6. Screening of Marc-145 cells transfected by the recombinant eukaryotic expression vector pEGFP-Nsp2 expressing Nsp2 gene stably Firstly, the recombinant plasmid pEGFP-Nsp2 was transfected into 80%-90% of Marc-145 cells, and they were cultured by MEM cell culture medium containing 8% of fetal bovine serum (Hyclone). After 72 h of transfection, the cells diluted differently were transferred into a new 24-well plate and were cultured continuously in the MEM cell culture medium containing 0.6 g/L G418 fluid. During the culture period, the culture solution was renewed every 4-7 d. The selected live cells were cloned and cultured for 3-4 weeks. The obtained cell lines was named Marc-145-Nsp2 cell lines.
1.7. Detection of Nsp2 gene expression in Marc-145 cell lines
1.7.1. Observation by a fluorescence microscope. Within 18-72 h after the recombinant eukaryotic expression vector pEGFP-Nsp2 was transfected into Marc-145 cells, fluorescent cells were observed by a fluorescence microscope, and then the transfection efficiency and expression condition of Nsp2 protein could be judged according to fluorescent cells' number and intensity (EGFP expression).
1.7.2. Detection of Nsp2 protein in the cell lines by using PCR and RT-PCR. Based on the methods of "1.3.2." and "1.3.3.", the cell lines and normal Marc-145 cells' genomic DNA and total RNA were extracted, and RNA was transcribed to cDNA with the aid of Oligo dT primer. Afterwards, the primer Ns-U/Ns-L, compounded cDNA and genomic DNA were identified by PCR.
1.7.3. Detection of Marc-145-Nsp2 cell lines' stability. Marc-145-Nsp2 cells were cultured according to the culture method of Mare-145 cells, with 25 continuous passages. After many passages, cryopreservation had no obvious effect on the survival ability of cells. The recovered cells' genomic DNA and total RNA were extracted to be identified by PCR and RT-PCR according to the method of "1.3.".
1.8. Drawing of cell growth curves Marc-145 cells and Marc-145-Nsp2 cell lines were respectively inoculated in 24-well culture plates where there were 20 000 cells in each aperture. Cells were collected from three apertures every 24 h in 6 successive days, and the average quantity of the cells on each day were calculated to draw cell growth curves.
1.9. Measurement of PRRSV proliferation on cell lines Firstly, 0.1 MOI of PRRSV TJM was transfected into Marc-145, Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells respectively, and then these cells were cultured by the cell maintenance solution containing 2% fetal bovine serum for 72 h at 37 ℃ in a temperature box with 5% CO2. Cytopathic effect (CPE) was observed every day, and 1 ml of viral supernatant was collected to measure tissue culture infective dose (TCID50) every 12 h since the transfection was conducted for 20 h.
2. Results
2.1. Cloning of Nsp2 gene of PRRSV Through RT-PCR, PRRSV TJ was amplified to obtain a specific DNA fragment with a length of 2 865 bp, and the amplified TJM had a length of 2 505 bp (Fig.1), conforming with the expectation. The sequencing results revealed that the amplified gene sequences were correct.
M. Marker DL15000; 1. Control H2O; 2. RT-PCR product of Nsp2 gene of PRRSV TJ strain; 3. RT-PCR product of Nsp2 of PRRSV TJM strain.
Fig .1 Amplified products of Nsp2 gene of PRRSV TJ strain by RT-PCR
2.2. Construction of recombinant eukaryotic expression vector The Nsp2 gene of PRRSV was cloned into the vector pEGFP-N1, and the size of the insert was identified by restriction enzyme digestion, which was consistent with the expectation (Fig.2). The result revealed that the construction of ukaryotic expression vectors pEGFP-TJ Nsp2and pEGFP-TJ M Nsp2 was successful.
M.Marker DL15000; 1. pEGFP-TJM Nsp2/PstI+BamHI; 2. pEGFP-TJ Nsp2 /PstI+BamHI.
Fig .2 Restriction digestion analysis of recombinant plasmids
2.3. Determination of the optimal working mass concentration of G418 Through 14 d of screening, the most suitable working mass concentration of G418 (the minimum lethal mass concentration was determined, namely 0.6 g/L. After being screened by G418 with the mass concentration of 0.6 g/L, all Marc-145 cells without the resistant gene were died within two weeks.
Table 1 Death rate of Marc-145 cells under various G418 mass concentrations %
|
Time//d
|
G418 mass concentration //g/L
|
|
0.1
|
0.3
|
0.6
|
0.9
|
1.0
|
|
3
6
9
12
14
|
10-20
|
20-30
|
25-35
|
35-45
|
50-75
|
|
15-20
|
30-45
|
30-45
|
55-80
|
75-95
|
|
20-30
|
35-55
|
50-80
|
75-90
|
100
|
|
25-35
|
40-65
|
75-90
|
100
|
100
|
|
30-45
|
60-70
|
100
|
100
|
100
|
2.4. Construction of the cell lines expressing Nsp2 gene stably Marc-145 cells transfected by the recombinant plasmids pEGFP-TJ Nsp2 and pEGFP-TJM Nsp2 were screened by 0.6 g/L G418 culture medium to obtain Anti-G418 Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cell lines growing and expressing PRRSV Nsp2 stably (Fig.3). In addition, it was found that there was no difference of the two cell lines and Marc-145 cells in the growth shape and state.
A. Spots of Marc-145-TJ Nsp2 cells expressing PRRSV TJ Nsp2; B. Marc-145-TJ Nsp2 cells growing stably ; C. Spots of Marc-145-TJM Nsp2 cells expressing PRRSV TJM Nsp2; D. Marc-145-TJM Nsp2 cells growth stably.
Fig .3 Cell lines screened by G418
2.5. Detection and expression of Nsp2 gene in Marc-145 cells Within 24-72 h after the recombinant eukaryotic expression plasmid pEGFP-Nsp2 was transfected into Marc-145 cells, 15%-30% of cells with green fluorescence were observed by a fluorescence microscope (Fig.4A), which showed that the EGFP expression fusing Nsp2 gene could express effectively. Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells expressing Nsp2 gene stably were obtained after 14 d of selection by G418. Taking the extracted DNA and RNA from the cells as templates, the special fragment of Nsp2 gene was amplified by PCR (the results were not shown) and RT-PCR (Fig.4B) using primer pair Ns-U/Ns-L, while the special fragment was not produced from Marc-145 cell control. Moreover, after several passages, cryopreservation and recovery of the cells, the special fragment of Nsp2 gene could still be detected, which indicated that Nsp2 gene had been fused in the cell genome and existed stably.
A. The EGFP expression after transient transfection inspected by electron microscope; B. PCR results of cells expressing Nsp2 gene of PRRSV; M. Marker DL15000; 1. Passages 2 of Marc-145-TJ Nsp2 cells ; 2. Passage 4 of Marc-145-TJ Nsp2 cells; 3. Passage 6 of Marc-145-TJ Nsp2 cells; 4. Passage 8 of Marc-145-TJ Nsp2 cells; 5. Passage 2 of Marc-145-TJM Nsp2 cells; 6. Passage 4 of Marc-145-TJM Nsp2 cells; 7. Passage 6 of Marc-145-TJM Nsp2 cell; 8. Passage 8 of Marc-145-TJM Nsp2 cells; 9. Marc-145 cell control.
Fig.4 Expression of Nsp2 gene of PRRSV on cells
2.6. Cell growth curves Using the same culture method, original Marc-145 cells and infected cells (Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells) had no significant difference in their growth properties (Fig.5). When culture conditions, number of inoculated cells and observation time were identical, the two kinds of cells had a similar proliferation speed.
Fig.5 Proliferative curves of Marc-145, Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells
2.7. Proliferation of PRRSV on various cells As shown in Fig.6, after the cells were infected by PRRSV, PRRSV proliferation was faster on Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells compared with Marc-145 cells. In addition, cytopathic effect was more distinct in the first 40 h, and the multiplication coefficient of PRRSV on Marc-145-TJ Nsp2 cells was larger than that on other cells, reaching the maximum TCID50 finally, followed by Marc-145-TJM Nsp2 cells. PRRSV replication in early stage was promoted by Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells, that is, Nsp2 protein played a positive role in early phase of PRRSV proliferation.
Fig.6 Growth kinetics of PRRSV TJM on Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells
3. Discussion
The Nsp2 protein of PRRSV is a nonstructural protein with a great variation in the genome of PRRSV, and its gene diversity is closely related to its functions. At present, there are numerous studies on the variation analysis of Nsp2 sequence[7-12], and different degrees of genetic variation can be found in both European I and North American II Nsp2, existing gene insertion or deletion. The nonstructural protein Nsp2 has a special property, which is closely correlated with the tissue tropism and Pathogenicity of PRRSV. For instance, using reverse genetics, Kim DY et al. used the infectious cDNA of PRRSV to clone several mutant strains with Nsp2 deletion, and found that the virus, lacking 131 amino acids (P129's 3219-3614, amino acids 628-759) in relatively conservative and non-essential regions of Nsp2, had the normal yield in Marec-145 and PAM cells, but the pathogenic toxicity of the mutant strains with Nsp2 deletion to piglets decreased. The deletion of 30 amino acids has occurred at 480 and 531-559 site, which can be found in all epidemic strains of highly pathogenic PRRSV as the pathogen of "unknown high heating" disease happening in China since 2006[14-15]. Highly pathogenic PRRSV TJ strain separated by our laboratory also has the same genetic fingerprint. However, we are unable to conclude the relationship between Nsp2 gene deletion and toxicity variation from previous researches, and it is difficult to judge the specific effects of Nsp2 protein functions on PRRSV replication at present.
In this study, Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells expressing Nsp2 gene of highly pathogenic PRRSV TJ and attenuated TJM stably were constructed, and the effects of Nsp2 gene expression on PRRSV replication were discussed. The successfully constructed plasmids pEGFP-TJ Nsp2 and pEGFP-TJM Nsp2 expressing Nsp2 protein stably, containing enhanced green fluorescent protein expression box, were transfected into Marc-145 cells and screened by G418, and finally Anti-G418 Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells expressing Nsp2 protein stably were obtained. The results of the fluorescence microscope observation, PCR and RT-PCR detection showed that Nsp2 gene could express stably in Marc-145 cells, and the growth properties of Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells were similar to those of Marc-145 cells. After the cells were infected by PRRSV, PRRSV proliferation was faster on Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells compared with Marc-145 cells. In addition, compared with Marc-145 cells, the cytopathic effect of Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells was more obvious in early stage, reaching a higher TCID50 finally. Additionally, the multiplication coefficient of PRRSV on Marc-145-TJM Nsp2 cells was slightly smaller than that on Marc-145-TJ Nsp2 cells. Compared with the Nsp2 gene of PRRSV TJ strain, the Nsp2 gene of PRRSV TJM strain lacked 120 amino acids，so it might be because that the deletion of the 120 amino acids changed the secondary structure of Nsp2 protein, and thereby altered its control on PRRSV. In addition, the results revealed that PRRSV replication in early stage was promoted by Marc-145-TJ Nsp2 and Marc-145-TJM Nsp2 cells, that is, Nsp2 protein played a positive role in early phase of PRRSV proliferation. In a word, the construction of Marc-145-Nsp2 cell lines provided data for the further discuss of PRRSV replication mechanism.
References
［1］JUSA E R, Y INABA, M KOHNO, et al. Hemagglutination with porcine reproductive and respiratory syndrome virus[J]. J Vet Med Sci, 1996，58(6):521-527.
［2］MEULENBERG J J, A PETERSEN-DEN BESTEN, E P DE KLUYVER,et al. Characterization of structural proteins of Lelystad virus[J]. Adv Exp Med Biol, 1995. 380:271-276.
［3］MARDASSI H, S MOUNIR, S DEA.Structural gene analysis of a Quebec reference strain or porcine reproductive and respiratory syndrome virus (PRRSV) [J]. Adv Exp Med Biol, 1995， 380:277-281.
［4］HAN J G,LIU Y,WANG, et al.Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture[J]. J Virol, 2007,81(18):9878-9890.
［5］RAN Z G, X Y CHEN, X GUO, et al., Recovery of viable porcine reproductive and respiratory syndrome virus from an infectious clone containing a partial deletion within the Nsp2-encoding region[J]. Arch Virol, 2008,153(5):899-907.
［6］MOSER C, P STETTLER, J D TRATSCHIN, et al.Cytopathogenic and noncytopathogenic RNA replicons of classical swine fever virus[J]. J Virol, 1999,73(9):7787-7794.
［7］ALLENDE R, T L LEWIS, Z LU, et al.North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions[J]. J Gen Virol, 1999, 80 ( Pt 2):307-315.
［8］SHEN S, J KWANG, W LIU, et al. Determination of the complete nucleotide sequence of a vaccine strain of porcine reproductive and respiratory syndrome virus and identification of the Nsp2 gene with a unique insertion[J]. Arch Virol, 2000,145(5):871-883.
［9］YOSHII M, T OKINAGA, A MIYAZAKI, et al.Genetic polymorphism of the nsp2 gene in North American type--porcine reproductive and respiratory syndrome virus[J].Arch Virol, 2008,153(7):1323-1334.
［10］GAO Z Q, X. GUO, H C YANG.Genomic characterization of two Chinese isolates of porcine respiratory and reproductive syndrome virus[J]. Arch Virol, 2004,149(7):1341-1351.
［11］FANG Y, D Y KIM, S ROPP, et al.Heterogeneity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the United States[J]. Virus Res, 2004, 100(2):229-235.
［12］ROPP S L, C E WEES, Y FANG, et al.Characterization of emerging European-like porcine reproductive and respiratory syndrome virus isolates in the United States[J]. J Virol, 2004, 78(7):3684-3703.
［13］KIM D Y, T J KAISER, K HORLEN, et al.Insertion and deletion in a non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and respiratory syndrome (PRRS) virus: effects on virulence and immunogenicity[J]. Virus Genes, 2009,38(1):118-128.
［14］LI Y, X WANG, K BO, et al. Emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China[J].Vet J, 2007,174(3):577-584.
［15］ZHOU Y J, X F HAO, Z J TIAN, et al. Highly virulent porcine reproductive and respiratory syndrome virus emerged in China[J]. Transbound Emerg Dis, 2008,55(3/4):152-164.
Acknowledgements
Supported by the State "863" Project of China (2011AA10A213); National Key Technology R & D Program in the 11
th Five Year Plan of China (2009BADB4B02).
About the Author
WANG Feng-xue (1978- ), female, P.R. China, Doctor, assistant researcher, engaging in the study of molecular biology of animal viruses.
Received: April 6,2012 Accepted: May 5,2012
*Corresponding author.